Изучение частоты встречаемости вариантов промоторного участка гена серотонинового транспортера 5-HTTLPR в группе долгожителей Кабардино-Балкарской Республики
научный журнал «Актуальные исследования» #21 (24), ноябрь '20

Изучение частоты встречаемости вариантов промоторного участка гена серотонинового транспортера 5-HTTLPR в группе долгожителей Кабардино-Балкарской Республики

Много долгожителей на Кавказе, именно здесь регистрируются национально-этнические группы с высоким индексом долголетия. Полученные в результате изучения ДНК долгожителей КБР результаты позволят создать панель диагностических маркеров для комплексного исследования рисков возникновения болезней старения и разработки профилактических мер для продления активной и работоспособной жизни населения КБР.

Аннотация статьи
Ключевые слова

Долгожители – представители максимальной видовой продолжительности жизни человека. Поиск механизмов и факторов, определяющих долголетие, осуществляется на различных уровнях – от популяционного до молекулярно-клеточного. Долгожители встречаются во всех странах. Вместе с тем, изучение географии долгожительства показало, что районы, где живут долгожители, распределены неравномерно. Много долгожителей на Кавказе, именно здесь регистрируются национально-этнические группы с высоким индексом долголетия. Полученные в результате изучения ДНК долгожителей КБР результаты позволят создать панель диагностических маркеров для комплексного исследования рисков возникновения болезней старения и разработки профилактических мер для продления активной и работоспособной жизни населения КБР.

Целью исследования явилось изучение частоты встречаемости вариантов промоторного участка гена серотонинового транспортера 5-HTTLPR (длинный и короткий, L и S аллели) в группе долгожителей Кабардино-Балкарской республики и сопоставление популяционного распределения данного полиморфизма в этом регионе и в других странах. Одновременно нами была предпринята попытка выявить средовые факторы, которые влияют на долголетие ассоциированные с долголетием в изученной группе долгожителей КБР.

Впервые проводилась работа по сбору коллекции ДНК долгожителей Кабардино-Балкарской республики на базе Медико-Биологического Центра КБГУ. Изученная группа долгожителей проанализирована на наличие ДНК-полиморфизма в гене транспортера серотонина 5HTTLPR, который ранее был ассоциирован с долголетием в различных популяциях. Изучена взаимосвязь долголетия и средовых факторов в группе долгожителей КБР.

Для проведения настоящего исследования сбор образцов крови жителей КБР, достигнувших 84-х летнего возраста, проводился по месту жительства исследуемых в период 2019-2020 гг.

Данные о каждом участнике эксперимента собраны путем опроса и занесены в специально разработанную формализованную карту. Анкета заполнялась индивидуально на каждого участника исследования. При обработке информации учитывались сведения о исследуемых, включающие возраст, национальность, место рождения, место проживания, образование, наличие долгожителей среди родственников, особенности диеты, принимаемые в настоящее время лекарственные средства, черты характера долгожителя, уровень употребления спиртных напитков, курение.

В ходе научно-исследовательской работы создан банк биологического материала: цельная кровь и ДНК долгожителей, проживающих на территории Кабардино-Балкарской республики (45 человек от 84 до 104 лет, средний̆ возраст 88,56. ± 1.60 года). В ходе выполнения работы были использованы клинические и лабораторные методы исследования. Исследуемым материалом служила венозная периферическая кровь. Выделение ДНК проводилось из лимфоцитов периферической венозной крови вручную с помощью набора «QIAmp DNA bood Mini Kit».

Генотипирование проводили методом аллель-специфичной ПЦР. Амплификацию проводили с использованием готовых наборов GenePakTM PCR Core согласно инструкциям производителя на приборе – амплификатор My Cycler Thermal Cycler.

Полиморфизм гена транспортера серотонина 5HTTLPR определяли с помощью полимеразной цепной реакции (ПЦР) и последующей идентификации различий длин продуктов [1, с. 43].Для постановки ПЦР использовали следующие праймеры: 5HTT – F 5' – CAATGTCTGGCGCTTCCCCTACATAT – 3' (прямой праймер); 5HTT – R 5' – GACATAATCTGTCTTCTGGCCTCTCAAG – 3' (обратный праймер).

Для аллеля L ожидаемая длина продукта амплификации 300 п.н., для аллеля S – 256 п.н.

При ПЦР-анализе гена серотонинового транспортера 5-НТТ в изученной группе долгожителей КБР выявлялись все ранее описанные генотипы. При исследовании полиморфизма гена серотонинового транспортера 5- HTT у долгожителей КБР и при сравнении этих результатов с литературными данными, описывающими другие популяции, нами было показано, что частоты генотипов по гену 5-HTT (LL, LS, SS) оказались близки к значениям в ранее изученных группах из России и стран Европы, но отличаются от таковых в Бразилии, Китае, Японии и у афроамериканцев США. Данные приведены в таблице 1.

Более подробное исследование группы долгожителей выявило незначительное различие по полу в распределении частот генотипов гена 5-HTT.

При анализе аллельного распределения у мужчин и женщин в группе изученных долгожителей обнаружено минимальное увеличение аллеля L у мужчин (61,9%) по сравнению с женщинами (58,2%).

Таблица 1

Частоты генотипов по гену 5-HTT в разных популяциях и у долгожителей Кабардино-Балкарии


Частота генотипов по гену 5-HTT, %




Долгожители КБР (n=45)




Центральная Россия (n=524) (Голимбет и др., 2009)




Германия (n=315) (Herman et al., 2003)




США, Европеоиды (n=241) (Heyer et al., 2008)




Афроамериканцы (n=132) (Roy et al., 2007)




Финляндия (n=3872) (Munafò et al., 2009)




Китай (n=103) (Chong et al., 2000)




Япония (n=243) (Katsuyama et al., 2008)




Бразилия (n=201) (Meira-Lima et al., 2004)




К сожалению, малая величина выборки не дает возможность говорить о статистической достоверности наших данных, и вполне вероятно, что при увеличении количества исследуемых долгожителей эта тенденция будет усиливаться.

Тем не менее, результаты наших исследований оказались сопоставимы с литературными данными об увеличение частоты генотипа LL, часто выявляемого у спортсменов, среди мужчин возрастной̆ группы 80-89 лет и данными от том, что пожилые представители мужского пола достоверно чаще несут L вариант гена серотонинового транспортера [3, с. 620; 5, с.111].

Впрочем, малая величина изученной выборки долгожителей в данном исследовании не позволяет сделать более чёткий̆ и надёжный̆ вывод о роли генотипа LL в достижении активного долголетия у долгожителей КБР.

Проведено социально-физиологическое обследование 45 долгожителей КБР, среди них 13 мужчин (28,9%) и 32 женщины (71,1%) [2].

Все исследуемые долгожители родились и всю свою жизнь проживают на территории КБР. На наш взгляд, отсутствие постоянной̆ миграции, смены климатических поясов является важным фактором, определяющим долголетие.

По медико-демографическим параметрам типичным долгожителем в нашем исследовании оказалась женщина, средний возраст которой составляет 88,95 лет, получившая начальное образование, 31,5 год проработавшая в сельском хозяйстве и вышедшая на пенсию по собственному желанию. Факт преобладания женщин среди людей старших возрастных групп известен, в этом отношении наше исследование не стало исключением.

Среднестатическая женщина-долгожитель из нашего исследования один раз в возрасте от 18 до 25 лет выходила замуж и имела от 2 до 6 детей, достигших совершеннолетия, потеряла супруга более 10 лет назад, проживает в сельской местности с кровными родственниками (детьми или внуками). Известно, что жители сельской местности в среднем живут на 5 лет больше горожан. Существенной этно-психической особенностью образа жизни долгожителей КБР является большая патриархальная семья.

Вопрос об уровне образования и его связи с долголетием остается открытым. Исследования показали, что большинство долгожителей в течение жизни занимались физическим трудом: 77,7% мужчин, 67% женщин. При опросе долгожителей КБР установлено, что большинство из них имеют неполное среднее образование, как среди мужчин (89,8%), так и среди женщин (93,5%).

В настоящее время активно изучаются семейные случаи долголетия, в связи с доказанным влиянием наследственности на продолжительность жизни. В исследуемой нами группе долгожителей КБР у 71,1% долгожителей имелись случаи долголетия в роду (а у мужчин этот результат еще выше - 84,6 %). (таблица 2). Частота встречаемости наследственного фактора, по нашему мнению, могла быть выше, поскольку не все долгожители помнили всю информацию о своих родственниках. Обращал на себя внимание тот факт, что частота наследственных факторов у мужчин-долгожителей в обеспечении долголетия была выше.

На момент обследования в структуре хронических заболеваний, характерных для пожилого возраста в группе долгожителей КБР наиболее часто встречалась гипертензия (33,3%), перенесенный инфаркт (4,44%) и диабет (2,22%). И ни у одного из долгожителей не отмечено старческого слабоумия. В группе мужчин частота случаев инфаркта оказалась выше, чем у женщин.

Параметры, соответствующие степени физической активности и степени самообслуживания оказались также различны у долгожителей разного пола. В нашем исследовании в группе мужчин-долгожителей все индивидуумы (100%) сохранили самообслуживание в полном объеме и были физически активны на момент исследования (таблица 2).

Интерес к питанию как фактору внешней среды, который может влиять на продолжительность жизни, поддерживается двумя обстоятельствами: питание может существенно влиять на сроки жизни, а также изменение питания человека – самый̆ простой и доступный̆ способ воздействия на продолжительность жизни по сравнению, например, с влиянием на экологию, политику или социально-экономические условия существования. Наиболее полно изучено воздействие калорийно ограниченного (на 40–50 % по сравнению с контролем), но полноценного (с добавками витаминов и минеральных компонентов) питания, что в основном связано с тем, что при его применении можно увеличить ПЖ на 50–60 %, а в некоторых случаях показано двукратное увеличение ПЖ (таблица 3).

Таблица 2

Анализ распределения социально-демографических факторов активного долголетия у долгожителей КБР



Средний возраст (лет)

Наследственное долголетие

Физическая активность и самообслуживание

Физический труд в течении жизни



















Таблица 3

Параметры, соответствующие степени физической активности и степени самообслуживания


N / %


Употребление алкоголя




Психические заболевания

Все долгожители
























В механизм формирования регионального долголетия определенный вклад вносят особенности традиционного стереотипа питания долгожителей. Пища исследуемой группы долгожителей КБР оказалась низкокалорийной. Высокое содержание в ней своеобразных кисломолочных продуктов обеспечивает сходство микрофлоры кишечника долгожителей и здоровых детей. Следует отметить и высокое содержание в рационе питания растительных продуктов (кукуруза), а, следовательно, и балластных веществ (клетчатки). Высокое потребление острых приправ из красного перца и чеснока, содержащего капсаицин, который способствует нормализации липидного обмена, снижению АД, свертываемости крови, участвует в терморегуляции.

Резюмируя вышеизложенное, следует отметить, что питание изученной группы долгожителей КБР характеризуется молочно-растительной ориентацией, а в качестве мясных продуктов преобладает мясо птицы, лишено практически всех основных алиментарных факторов риска развития возрастзависимой патологии и в целом отвечает современным требованиям геродиетики.

Исходя из результатов, можно считать, что мужчины-долгожители КБР продемонстрировали повышение взаимосвязи параметра физической активности и долголетия, а также повышенную частоту наследственного долголетия. Вероятно, этот факт можно объяснить тем, что мужчины должны обладать более выраженными адаптационными способностями для достижения предельного для человека возраста.

Текст статьи
  1. Голимбет В. Е., Алфимова М. В., Короваицева Г. И. Новые доказательства в пользу связи гена переносчика серотонина с шизотипическими чертами личности // Журн. неврол. и психиатр. - 2009. - No 5. - С. 43–47.
  2. Паритов А.Ю., Кумыкова З.Ю., Аджиева А.Х., Биттуева М.М., Боготова З.И., Гидова Э.М., Ситников М.Н., Хандохов Т.Х. Изучение функционально-значимого полиморфизма гена ACE и социо-физиологическая характеристика долгожителей КБР// Современные проблемы науки и образования. – 2017. – № 4. http://www.science-education.ru/article/view?id=26591
  3. Свидетельство о государственной регистрации базы данных №2019620553. 2019. Коков З.А., Бахова Д.К., Паритов А.Ю., Боготова З.И., Коков Н.А. База данных «Долгожители» для популяционного генетического анализа.
  4. Смирнова Т. Ю., Спивак Д. Л., Якупова Г. С. и др. Распределение структурных полиморфизмов генов ангиотензин – превращающего фермента и рецептора серотонина 5-HT2A у долгожителей Северо-Запада России // Успехи геронтол. - 2011. - Т. 24. - No 4. - С. 620–625.
  5. Спивак Д. Л., Сейлиева Н. А., Смирнова Т. Ю. и др. Психологические состояния в популяции долгожителей Северо-западного региона Российской Федерации и полиморфизма гена ангиотензинпревращающего фермента // Учен. записки СПбГМУ им. акад. И. П. Павлова. - 2009. - Т. 16. - No 4. – С. 111–114.
Список литературы
Ведется прием статей
Прием материалов
c 17 апреля по 23 апреля
Осталось 6 дней до окончания
Публикация электронной версии статьи происходит сразу после оплаты
Справка о публикации
сразу после оплаты
Размещение электронной версии журнала
27 апреля
Загрузка в eLibrary
27 апреля
Рассылка печатных экземпляров
05 мая